Review



non targeting sgrna lentiguidepuro control plasmid addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Addgene inc non targeting sgrna lentiguidepuro control plasmid addgene
    Non Targeting Sgrna Lentiguidepuro Control Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/non-targeting+control+gRNA+(BRDN0001487130)+(Plasmid+%2380262)/pm42864421-187-18-23
    Average 92 stars, based on 2 article reviews
    non targeting sgrna lentiguidepuro control plasmid addgene - by Bioz Stars, 2026-10
    92/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Receptor Switching in Newly Evolved Adeno-associated Viruses
    Article Snippet: .. A human genomewide Brunello plasmid library containing;80,000 sgRNAs targeting;20,000 human genes (Addgene, catalog no. 73179) was a gift from Stanley Lemon (UNC-Chapel Hill). .. To generate the lentivirus library, 10mg of Brunello pDNA pool, 7.5mg of psPAX2 (Addgene, catalog no. 12260), and 3mg of pVSVG (Addgene, catalog no. 8454) were resuspended in 500ml of serum-free DMEM and mixed with 500ml of serum-free DMEM containing PEI-max (5ml/mg of DNA), followed by incubation at room temperature for 15 min.



    Similar Products

    non targeting sgrna lentiguidepuro control plasmid addgene  (Addgene inc)
    92
    Addgene inc non targeting sgrna lentiguidepuro control plasmid addgene
    Non Targeting Sgrna Lentiguidepuro Control Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/non-targeting+control+gRNA+(BRDN0001487130)+(Plasmid+%2380262)/pm42864421-187-18-23
    Average 92 stars, based on 1 article reviews
    non targeting sgrna lentiguidepuro control plasmid addgene - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    crispra sgrnas targeting capn2  (Addgene inc)
    95
    Addgene inc crispra sgrnas targeting capn2
    Crispra Sgrnas Targeting Capn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/lentiSAMv2+(Plasmid+%2375112)/pm42772564-181-0-14
    Average 95 stars, based on 1 article reviews
    crispra sgrnas targeting capn2 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    sgrna sequences targeting trmt6  (Addgene inc)
    96
    Addgene inc sgrna sequences targeting trmt6
    Sgrna Sequences Targeting Trmt6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/lentiCRISPR+v2+(Plasmid+%2352961)/10__1186_slash_s40170___026___00452___3-88-0-13
    Average 96 stars, based on 1 article reviews
    sgrna sequences targeting trmt6 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    sgrna targeting setd1b  (Addgene inc)
    95
    Addgene inc sgrna targeting setd1b
    Sgrna Targeting Setd1b, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/lentiSAMv2+(Plasmid+%2375112)/pm41933071-93-14-25
    Average 95 stars, based on 1 article reviews
    sgrna targeting setd1b - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    cndp2 targeting sgrna paav u6 shrna spgrna cndp2 v2 0 cmv egfp wpre  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd cndp2 targeting sgrna paav u6 shrna spgrna cndp2 v2 0 cmv egfp wpre
    Cndp2 Targeting Sgrna Paav U6 Shrna Spgrna Cndp2 V2 0 Cmv Egfp Wpre, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/0+cmv+cndp2+cndp2+egfp+paav+sgrna+shrna+spgrna+targeting+u6+v2+wpre/pm42276307-138-7-22
    Average 86 stars, based on 1 article reviews
    cndp2 targeting sgrna paav u6 shrna spgrna cndp2 v2 0 cmv egfp wpre - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    plasmid transfection sgrnas targeting rnf214  (Genechem)
    86
    Genechem plasmid transfection sgrnas targeting rnf214
    Plasmid Transfection Sgrnas Targeting Rnf214, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/candidate+piezo1+sgrnas+targeting/pm42265556-71-3-20
    Average 86 stars, based on 1 article reviews
    plasmid transfection sgrnas targeting rnf214 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    cd14 targeting sgrna  (Genechem)
    86
    Genechem cd14 targeting sgrna
    Cd14 Targeting Sgrna, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/cbx2+sequences+sgrna+targeting/pmc13253277-138-11-21
    Average 86 stars, based on 1 article reviews
    cd14 targeting sgrna - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg  (Synthego Inc)
    86
    Synthego Inc sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg
    Sgrna Targeting Mouse Pcsk9 Cccauaccuuggagcaacgg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/cacuggaagagcaauggcug+gene+grna+mouse+targeting+trim32/pm42190011-200-1-13
    Average 86 stars, based on 1 article reviews
    sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    sgrnas targeting exon 2  (Synthego Inc)
    86
    Synthego Inc sgrnas targeting exon 2
    Sgrnas Targeting Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/sgrnas/pmc13198606-31-2-21
    Average 86 stars, based on 1 article reviews
    sgrnas targeting exon 2 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    optimal single guide rna sgrna target sequences  (Benchling Inc)
    86
    Benchling Inc optimal single guide rna sgrna target sequences
    Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrnas+targeting/guide+rna/pm42167230-305-5-14
    Average 86 stars, based on 1 article reviews
    optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results